                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAAACTGCTCATCGCGCAAAAGCTCAACGATTTTCGCCTGGCGGTCCTGAGTTGAG
TTGAACACCAAcgcttcccttccaacaagaaatggtctatatcgctcatactatgagcgtaatcgttcttcgtcaaatgaaagtttggtgac
agttttgttgcaacgcaacaatacattacaaacgattacgcattgttggggatcaagaagcttcgggtagctaagcggaagcctttgttagtgtgatcga
aatcgctcactttcgcaccgcaccaaaatcgtaagcttctaggaggagtgATG

    Atu6137 --- Atu6136 --- splA Gene: Atu6137     GI: 17939270     BI number: Atu6137     GOG: -------     Description: hypothetical protein Gene: Atu6136     GI: 17939269     BI number: Atu6136     GOG: COG1283     Description: conserved hypothetical protein Gene: splA     GI: 17939268     BI number: Atu6135     GOG: COG0366     Description: sucrose phosphorylas tc t  c c  a c  a c  c        c ta       a  t ta        ta cg        at g  a       cg c  a       ta A  a       cg At        gc Cg        cg Cg       t  t At       a  a |  c      t  | |  t      a  | |  a      t  | C  t      c  | A  a       ta At        gt Gc        gc        aa T  |       tg       g  a Tg       a  |       tg Gc        at        at At        at        at Gc        gc        at Ta        at        cg |  t       at       t  g Ta       |  c      g  t Gc        cg        cg At        at        ta                         cagttttgttgcaacgcaacaatacattacaaacgattacgcattgttggggatcaagaagcttcgggtagctaagcggaagcctttgttagtgtgatcgaaatcgctcactttcgcaccgcaccaaaatcgtaagcttctaggaggagtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1283 Na+/phosphate symporter ... can be seen here [G] COG0366 Glycosidases ... can be seen here     ..................................................................................................................