                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -5.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATTGGAGGCTGATCTACGAAGGGAGAAAAGCAGCAGACTGGCATCCCACAAGGCTC
TCTCGGCGTTGGATGCAATGCCGAACGAAAAACTCATTTTCCGCCTGAATTGCTCGCC
GAATTCGCGACGCACttgccattcggcaatccattggaaacggcagataatctcacgaatttttcagctcgcaagtcgccaagtgcggg
tgcggtttagggtaagcgcgcaataccccgcacctttttccgttgaatgagctgaggcatttggtgtccacctaaaatgaggtggacgccaaatcATG

    ynh Gene: ynh     GI: 17939293     BI number: Atu6160     GOG: COG2963     Description: conserved hypothetical protei   a t  a a  t gc at c  c g  a gc cg                   g |  a                g  g |  a                 at |  t                 ta at                  ta at         a        tg at       a  g       gc gt       c  t      |  g gc        cg        gc ta        gc        cg tg        cg        gc |  c       tg        ta a  t      g  g      |  a c  c      a  |      |  t c  g       at       |  a t  c       cg       |  c a  a       gc        gc a  a       cg        gc cg       t  |       gc gt        cg        cg gc        gt        gc cg        at        ta                         cctttttccgttgaatgagctgaggcatttggtgtccacctaaaatgaggtggacgccaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2963 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................