Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttgggaggcgagcgcgcgttgtcagcatatatgataccggcagcaagatctggcctgcgccttgggcgcaccgtataccggtcaggttcccgattgac
tttctcaccatcttttgatgttcctgccgcgcaggttcgcacctgttgaagcctaggtgcccgagccgttctttgcttgcgtcgcattgatgttgtccat
gatatcctccgtccactcgccgacctatagttggaatttgcaggtgttgacgagtgagataccacgttggttttcgtccagcgtggcgacaattttcatc
GTG

    Atu6163


Gene: Atu6163     GI: 17939296     BI number: Atu6163     GOG: -------     Description: hypothetical protei


                     aa
                    g  g
                    t  c
                    t  c
                     gt
                     ta
                     cg
                     cg
                     at
                     cg
           cg        gc
  g       t  c      |  c
c  c       ta       |  c
 cg        gc        cg
 gc        gc        ta
 ta        at        tg
 cg        cg        gc
 cg        gt        gc
                        gttctttgcttgcgtcgcattgatgttgtccatgatatcctccgtccactcgccgacctatagttggaatttgcaggtgttgacgagtgagataccacgttggttttcgtccagcgtggcgacaattttcatcGTG
    ..................................................................................................................