                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:103 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -6.60 kcal/mol
Antiterminator:    Distance from promoter:82 nt. Size=49 nt.     Delta G= -9.76 kcal/mol
Anti-antiterminator:    Distance from promoter:54 nt.    Size=46 nt.     Delta G= -3.41 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-CATgtt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAGAAAAAGTATTTCTTCCATgttatcctttccagaaatggaacgtccagcaatatgtattataggctttttaagc
ggtttcctttacaacgaaagcatatacagaagagccaaaaaagggaaaaatcccatagtaacctttcccgtgaggtttttcctcctcagcgttcttgttt
tctttatcgtttacttttacaaggctgaaggggctattctctttacgatttcccaccttctcgggcgtttcttccagctcttttttagagtaaggttaaa
ttagtagttATG

    kdsA --- modC --- aq_087 --- aq_088 --- aq_090 --- aq_091m Gene: kdsA     GI: 15605681     BI number: aq_085     GOG: COG2877     Description: 3-deoxy-d-manno-octulosonic acid 8-phosphate synthase Gene: modC     GI: 15605682     BI number: aq_086     GOG: COG4149     Description: Molybdenum transport system permease Gene: aq_087     GI: 15605683     BI number: aq_087     GOG: COG4831     Description: putative protein Gene: aq_088     GI: 15605684     BI number: aq_088     GOG: COG4831     Description: putative protein Gene: aq_090     GI: 15605685     BI number: aq_090     GOG: COG3255     Description: putative protein Gene: aq_091m     GI: 15607134     BI number: aq_091m     GOG: COG3829     Description: AAA family ATPas             t           a  a           c  g ta       c  t a  c      c  a t  a      t  a a  g      a  c c  a      a  c g  a       at a  g       at a  a       at a  g       gc g  c       gc c  c       gc a  a      a  g       tt a  a      a  t      t  c c  a      a  g      t  c a  a      a  a      t  t ta       a  |       gc ta       a  |       gc tg        cg        at cg        cg        gc cg        gt        ta ta        at       |  g ta        gt        gc ta        at        cg                         ttcttgttttctttatcgtttacttttacaaggctgaaggggctattctctttacgatttcccaccttctcgggcgtttcttccagctcttttttagagtaaggttaaattagtagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2877 3-deoxy-D-manno-octulosonic acid (KDO) 8-phosphate synthase ... can be seen here [P] COG4149 ABC-type molybdate transport system, permease component ... can be seen here [S] COG4831 Uncharacterized conserved protein ... can be seen here [S] COG4831 Uncharacterized conserved protein ... can be seen here [I] COG3255 Putative sterol carrier protein ... can be seen here [KT] COG3829 Transcriptional regulator containing PAS, AAA-type ATPase, and DNA-binding domains ... can be seen here     ..................................................................................................................