                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGGTTCAGCCTTTATGATGTTGTACCTTATCGCTCCTCCGATGAGGTAGGCTAGAAT
AACAATTCCTGCCATTCCCAGAATCGCATACTTTCCGAGAACGTAGTAAAGGAGAGGA
GCGGAAACCAGATATCCGCTTCCTATAATTGAGGCAAGAGGCGTGACTGCAACTGTCC
ATAGTCTCTTTCTTTCCAGAAATGGACTCAGGAAAAACAGGAGGTATAGGATAAAAGA
AGTAAAGACTATGTAGTCCGTAAGGGTTAAACGGTTAAGGATTTCCATtcgtgttaaattatat
tctcATG

    secG --- hemK --- hly3 Gene: secG     GI: 15605688     BI number: aq_098     GOG: COG1314     Description: protein export membrane protein SecG Gene: hemK     GI: 15605689     BI number: aq_099     GOG: COG2890     Description: protoporphyrinogen oxidase Gene: hly3     GI: 15605690     BI number: aq_101     GOG: COG1253     Description: hemolysi             A           A  T           T  T           A  G            TA            CG         A            CG       C  A           |  C      G  C            TA       T  T            TA        CG   A        CG        AT C  G      G  A       GC C  A       CG       |  C A  T       CG       |  A A  A      |  C      T  T AT        TG       G  A GC        AT        CG GC        TG        GT CG       A  A       GC GC        GC        AT AT        AT        GC GT        CG        AT                         TTCTTTCCAGAAATGGACTCAGGAAAAACAGGAGGTATAGGATAAAAGAAGTAAAGACTATGTAGTCCGTAAGGGTTAAACGGTTAAGGATTTCCATtcgtgttaaattatattctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG1314 Preprotein translocase subunit SecG ... can be seen here [J] COG2890 Methylase of polypeptide chain release factors ... can be seen here [R] COG1253 Hemolysins and related proteins containing CBS domains ... can be seen here     ..................................................................................................................