                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -9.23 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATGGGAACTGTTCTTAATATGTAGGCAACCACACCGACTTTGTATATGTCCTCTTC
CTTAGGTTCTTCTACATCTTTGTCCTTTTGAAGAACTAAGAATATAAGTTTGTCCTTT
TTGTTCGCCTCCTCAATAGCTCTTATTGAGAAACGCCTTCCTACAAAGAGAGGCTGAA
CCATTGTGGGGAAGATAACTATGTCCCTTAAAGGCATTAAGGGGTATTCTTTAATTCC
CGCTTCTACCTGAGGGGTTTGAAATAGTTCGTTCACcttttctcctccttgtttttaaaattataccaATG

    aq_240 Gene: aq_240     GI: 15605787     BI number: aq_240     GOG: COG0714     Description: hypothetical protei CA A  A TA CG C  A T  G TA CG        TA CG       A  A GC        GC |  T       AT C  G      |  A A  A      |  T A  A      A  G A  C       GT         G G  C       GC       G  C A  A       GC       A  A G  T       GC        AT T  T      T  T       AT TG        GT        TA AT        TA        TA TG        TA        CG TG       A  A       CG CG        CG        CG TG        CG        TG                         TATTCTTTAATTCCCGCTTCTACCTGAGGGGTTTGAAATAGTTCGTTCACcttttctcctccttgtttttaaaattataccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0714 MoxR-like ATPases ... can be seen here     ..................................................................................................................