                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAAAAAACCTTTTACAAACTCTCCAAGTGAGTTCGTCCTTTGTTCTCGTAGAAAGCA
GTGCACACACCAGAACCCTGAAGGGATCTTTATCGTGCTGGGCTATCATGTGAACTAC
GGGAGCATTCCATTTCGGAAATTCCCTTTTTAGAATTTCAAGAACTTTAGGCACGTCT
TCCCTTTTCATaagggaagattttatgggatttgtagaatggacattaatgagaagaaagtttttggcgcaaaggattttgtgattaatatc
atagaactttttgtgataatactcatattaggagGTG

    acrR3 --- aq_278 --- aq_277 --- aq_276 Gene: acrR3     GI: 15605818     BI number: aq_281     GOG: COG1309     Description: transcriptional regulator (TetR/AcrR family) Gene: aq_278     GI: 15605817     BI number: aq_278     GOG: COG1924     Description: hypothetical protein Gene: aq_277     GI: 15605816     BI number: aq_277     GOG: COG3580     Description: putative protein Gene: aq_276     GI: 15605815     BI number: aq_276     GOG: COG3581     Description: putative protei            TT           T  T           C  T           C  A            CG            TA            TA            AT            AT            AT            GC           G  A           C  A            TG            TA            TA           A  C           C  T           C  T           T  T           T  A           A  G            CG            GC           |  A           |  C           |  G           |  T   T       |  C T  T      |  T A  C       AT         C CG        GC       T  A CG        GC       T  T TA        GC        Ta TA       C  T       Ta A  A      A  T       Cg C  |      T  |       Cg GT       C  |       Cg AT        AT        Ta GC        AT        Ta GC        GC        Cg GC        TA        Ta                         ttttatgggatttgtagaatggacattaatgagaagaaagtttttggcgcaaaggattttgtgattaatatcatagaactttttgtgataatactcatattaggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here [I] COG1924 Activator of 2-hydroxyglutaryl-CoA dehydratase (HSP70-class ATPase domain) ... can be seen here [S] COG3580 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3581 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_aeolicus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=46 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TCAAAAAACCTTTTACAAACTCTCCAAGTGAGTTCGTCCTTTGTTCTCGTAGAAAGCA GTGCACACACCAGAACCCTGAAGGGATCTTTATCGTGCTGGGCTATCATGTGAACTAC GGGAGCATTCCATTTCGGAAATTCCCTTTTTAGAATTTCAAGAACTTTAGGCACGTCT TCCCTTTTCATaagggaagattttatgggatttgtagaatggacattaatgagaagaaagtttttggcgcaaaggattttgtgattaatatc atagaactttttgtgataatactcatattaggagGTG     acrR3 --- aq_278 --- aq_277 --- aq_276 Gene: acrR3     GI: 15605818     BI number: aq_281     GOG: COG1309     Description: transcriptional regulator (TetR/AcrR family) Gene: aq_278     GI: 15605817     BI number: aq_278     GOG: COG1924     Description: hypothetical protein Gene: aq_277     GI: 15605816     BI number: aq_277     GOG: COG3580     Description: putative protein Gene: aq_276     GI: 15605815     BI number: aq_276     GOG: COG3581     Description: putative protei TC A  A T  T CG GT G  G G  A T  A C  C GT         T TA       T  T GC       A  C CG        CG TG        CG A  G       TA T  A       TA T  G      A  A T  C      C  | C  A       GT T  T       AT AT        GC GC        GC GC        GC             TTTTTAGAATTTCAAGAACTTTAGGCACGTCTTCCCTTTTCATaagggaagattttatgggatttgtagaatggacattaatgagaagaaagtttttggcgcaaaggattttgtgattaatatcatagaactttttgtgataatactcatattaggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here [I] COG1924 Activator of 2-hydroxyglutaryl-CoA dehydratase (HSP70-class ATPase domain) ... can be seen here [S] COG3580 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3581 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................