                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.54 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -3.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tattactgatattttaaaactttagtttttcaacctcttgaatataacaattctgacctttttattttcgtggtcctctttcagtacaaccacgtgagtg
tattctgaaagtttttctccctttttcacttctccgctttttctatctatgtagtaaatggtgaaatcggaatactcttcctctttgaattcctcaagtg
gtcttatcttcatatccacgtccgcggttctgtatccgtatataagcccaagcaagaagttaaaagccttatcacctttcaggaactgcataatataatt
ATG

    rfaD --- arsA2 Gene: rfaD     GI: 15605858     BI number: aq_344     GOG: COG0451     Description: ADP-L-glycero-D-manno-heptose-6-epimerase Gene: arsA2     GI: 15605857     BI number: aq_343     GOG: COG0003     Description: anion transporting ATPas                      tg                     g  a                      cg                      at                      cg            tc       c  t           t  a      a  a   t       t  g      a  t a  t      c  t      c  t t  t      t  a      a  | t  t      c  c      t  | t  c      c  a       gc t  g       ta        at t  t       gc        cg cg        gc        ta cg        ta        ta at        gc        ta gc        cg        cg                         tttttctccctttttcacttctccgctttttctatctatgtagtaaatggtgaaatcggaatactcttcctctttgaattcctcaagtggtcttatcttcatatccacgtccgcggttctgtatccgtatataagcccaagcaagaagttaaaagccttatcacctttcaggaactgcataatataattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here [P] COG0003 Oxyanion-translocating ATPase ... can be seen here     ..................................................................................................................