                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:16 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:106 nt. Size=25 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TACTTT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAACGAGGCGTGTTATTTACTTTGGCTTTGTTAATAGCTACAGCAACGCCTTTT
TTAATATCTGTCAGCATggctctcacatccctttttatctttcaatttaggttttaaatgttaagaaggttaggaggcaggattggtt
aacataattgccattatgttaacattttattaccggaggcatccagATG

    bcp --- aq_459 --- aq_460 --- gatB --- aq_465 --- aq_467 --- czcB3 --- acrD3 --- aq_473 Gene: bcp     GI: 15605946     BI number: aq_458     GOG: COG1225     Description: bacterioferritin comigratory protein Gene: aq_459     GI: 15605947     BI number: aq_459     GOG: COG1913     Description: hypothetical protein Gene: aq_460     GI: 15605948     BI number: aq_460     GOG: -------     Description: putative protein Gene: gatB     GI: 15605949     BI number: aq_461     GOG: COG0064     Description: glutamyl-tRNA (Gln) amidotransferase subunit B Gene: aq_465     GI: 15605950     BI number: aq_465     GOG: -------     Description: putative protein Gene: aq_467     GI: 15605951     BI number: aq_467     GOG: -------     Description: putative protein Gene: czcB3     GI: 15605952     BI number: aq_468     GOG: COG0845     Description: cation efflux system (czcB-like) Gene: acrD3     GI: 15605953     BI number: aq_469     GOG: COG3696     Description: cation efflux system (AcrB/AcrD/AcrF family) Gene: aq_473     GI: 15605954     BI number: aq_473     GOG: NOG05161     Description: putative protei   t        gc t  a      t  c g  a       ta gc        at ta        at t  t       ta a  a       at g  a       cg gt        at at        at cg        ta gc        ta gc        gc             attttattaccggaggcatccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1225 Peroxiredoxin ... can be seen here [R] COG1913 Predicted Zn-dependent proteases ... can be seen here [J] COG0064 Asp-tRNAAsn/Glu-tRNAGln amidotransferase B subunit (PET112 homolog) ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here [P] COG3696 Putative silver efflux pump ... can be seen here     ..................................................................................................................