Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTATTATGTTTTGTTGAACTTCGGGCGGAAGACACCAAAACTCAAGACTGTCCCAGA
ATTTCCCATTATACCTCCTCCACGCGGGAGCAAGGGGTTTAGTTTCTACCTTGAAGTA
CTCTATTAATTCCTTTCTATAGGGATTCAGTTCAGGGAACCTGTTCTTTTCCCTGTTT
TCCCATATTGAGAAGTAGTCCTCCTTTACGAGGTCCATCGTGGACTGCTTTTTCTCCG
AAGGAAGCAGGTAAAAAATCATgagatttattttagcccaaaagaaggcatgttaaaatttccctaagATG

    aq_645


Gene: aq_645     GI: 15606069     BI number: aq_645     GOG: COG1700     Description: putative protei



           TC
          G  C
          G  A
           AT
           GC
           CG
           AT
          T  |
          T  |
          T  |
          C  |
          C  |
          T  |
           CG
 TT        CG
T  A       TA
C  C       GC
 CG        AT
 TA        TG
 CG        GC
 CG        AT
            TTTTCTCCGAAGGAAGCAGGTAAAAAATCATgagatttattttagcccaaaagaaggcatgttaaaatttccctaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG1700 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................