                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-19.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTAAGTTTCTACGACTTTCCCCTGAGCGTCGTAGGTGTCCGTCTCTGCACCGAAC
TTAACCGTAAACCTGTAAGTTTTAGGCATCCCTATAAAGAACTGCGAAAACCTCGTAG
CCTTGTTTATGAGGATTATGAGGAGTCCCGTGGCAATAGGATCGAGGGTTCCCGTGTG
CCCCGCCTTTCTTGCCTTCAGTTTTTCCTTTACCCTTTCCACTACTTCCGTGGAGGTT
ATTCCCTTTGGCTTGTCTATCAGAAGTGCTCCGTCCATacacaaaattatcaatttaaaataaggcttAT
G

    trpB1 --- aq_707 --- hyuA Gene: trpB1     GI: 15606106     BI number: aq_706     GOG: COG0133     Description: tryptophan synthase beta subunit Gene: aq_707     GI: 15606107     BI number: aq_707     GOG: COG0665     Description: hypothetical protein Gene: hyuA     GI: 15606108     BI number: aq_708     GOG: COG0145     Description: N-methylhydantoinase            GA           T  G           A  G            TA            TG            AT            GC            GC           A  |            GC   A        TG A  C       AT A  C      T  | AT        TG GC        TG CG        GC GT        TA TA       |  A CG       |  T |  C       TA |  C       CG AT        CG AT       G  A G  G      A  T AT       T  |       CG AT        GC       C  T AT        CG       C  G TA        TA       T  T AT        CG        TG TG        CG        GC C  A      A  G       GC CG       A  |       GC CG        AT       A  | TA        AT        GC AT        GC        CG                         CCTTTCTTGCCTTCAGTTTTTCCTTTACCCTTTCCACTACTTCCGTGGAGGTTATTCCCTTTGGCTTGTCTATCAGAAGTGCTCCGTCCATacacaaaattatcaatttaaaataaggcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [EQ] COG0145 N-methylhydantoinase A/acetone carboxylase, beta subunit ... can be seen here     ..................................................................................................................