                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAATGTTCAGGACCTTTAACATGGGCGTGGGAATGATAGTTATTCTGGACAAAGAAG
AGTTTGATAAGGCAAGGGAGTTAATACCGGAGTCCTTTTACTTGGGTGAAATCCTTGC
GGGAAGAAAGGAAGTGGAAATCCTGTAGcccgtctttctttcgctcttttgcttttgtttaaagtggtaataagcgtaa
gccataactataaagaaaaaaattaaggttgctatccttacccacctcttgaagcgggcgtacttaaactggtccgacatggtttttattttagaataaa
gacccATG

    aq_770 --- aq_771 --- tly --- aq_775 Gene: aq_770     GI: 15606153     BI number: aq_770     GOG: COG1561     Description: putative protein Gene: aq_771     GI: 15606154     BI number: aq_771     GOG: COG1561     Description: putative protein Gene: tly     GI: 15606155     BI number: aq_773     GOG: COG1189     Description: hemolysin Gene: aq_775     GI: 15606156     BI number: aq_775     GOG: COG1559     Description: hypothetical protei            AA           G  A   A       T  T       CT T  C       GC       C  G A  C       GC       T  T A  G       GT       A  A TG       |  T      A  G TA       |  G      A  c G  G      T  C       Gc AT        TG        Gc GC        CG        Tg GC       |  G      |  t GT       |  A       Gc AT       A  A       At AT        TG        At C  T       TA        Gt G  A       TA        Gc GC        TA        At AT        CG        At AT        CG        At TG        TA        Gc                         gctcttttgcttttgtttaaagtggtaataagcgtaagccataactataaagaaaaaaattaaggttgctatccttacccacctcttgaagcgggcgtacttaaactggtccgacatggtttttattttagaataaagacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1561 Uncharacterized stress-induced protein ... can be seen here [S] COG1561 Uncharacterized stress-induced protein ... can be seen here [J] COG1189 Predicted rRNA methylase ... can be seen here [R] COG1559 Predicted periplasmic solute-binding protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_aeolicus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:144 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-12.10 kcal/mol Antiterminator: Size=19 nt.     Delta G= -3.20 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-15.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAAATGTTCAGGACCTTTAACATGGGCGTGGGAATGATAGTTATTCTGGACAAAGAAG AGTTTGATAAGGCAAGGGAGTTAATACCGGAGTCCTTTTACTTGGGTGAAATCCTTGC GGGAAGAAAGGAAGTGGAAATCCTGTAGcccgtctttctttcgctcttttgcttttgtttaaagtggtaataagcgtaa gccataactataaagaaaaaaattaaggttgctatccttacccacctcttgaagcgggcgtacttaaactggtccgacatggtttttattttagaataaa gacccATG     aq_770 --- aq_771 --- tly --- aq_775 Gene: aq_770     GI: 15606153     BI number: aq_770     GOG: COG1561     Description: putative protein Gene: aq_771     GI: 15606154     BI number: aq_771     GOG: COG1561     Description: putative protein Gene: tly     GI: 15606155     BI number: aq_773     GOG: COG1189     Description: hemolysin Gene: aq_775     GI: 15606156     BI number: aq_775     GOG: COG1559     Description: hypothetical protei TT C  T C  T TA GC AT GT G  G                 GG CG                 T  A CG                 G  A AT                 A  A TG                  AT A  A                 GC A  A                 GC T  A                 AT T  |        G       A  G G  |      G  A      A  T A  |      G  A      G  A GT       C  G      A  G GC       G  A      A  | GC        TA        Gc AT        TA        Gc AT        CG        Gc CG        CG        Cg GC        TA        Gt                         ctttctttcgctcttttgcttttgtttaaagtggtaataagcgtaagccataactataaagaaaaaaattaaggttgctatccttacccacctcttgaagcgggcgtacttaaactggtccgacatggtttttattttagaataaagacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1561 Uncharacterized stress-induced protein ... can be seen here [S] COG1561 Uncharacterized stress-induced protein ... can be seen here [J] COG1189 Predicted rRNA methylase ... can be seen here [R] COG1559 Predicted periplasmic solute-binding protein ... can be seen here     ..................................................................................................................