                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=69 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCTTTTAAGAAATCTTCGGAGAAACGGAAGTTTATAAAACCTTTTACCGCCTCAAC
GCTTTTGAAAGTCTCGTCTTTTGATAAGAAATCCGCTAGCTCCTGGGCTATATTTACG
GGAGGTTTTTTTAGTTCTCTTGCAAGCAGGAACGCTACATTCGAGGCGAGGTCTCCGT
GGGCTTCTTCCTTTGGCTTTTCAACCTTGAAGTTTTCCACCTGTGTGTTGTAGAGTTC
CTTTAAAGCCTTAAGGACTTTCTCCTTTACGAGTTCTTTCATaggaactttattttatacttgtaggtG
TG

    aq_922 --- ftsY --- fdx1 Gene: aq_922     GI: 15606251     BI number: aq_922     GOG: COG0778     Description: putative protein Gene: ftsY     GI: 15606250     BI number: aq_920     GOG: COG0552     Description: cell division protein FtsY Gene: fdx1     GI: 15606249     BI number: aq_919a     GOG: COG0633     Description: ferredoxi             G           A  C           A  C           A  T           T  T            TA            TA            CG            CG           T  |            TA            GC            AT            GT            AT           T  C TC       G  T T  C      T  C T  A      T  C T  C      G  T GC       T  T AT        GT A  G       TA G  T       GC T  G      T  | T  T      C  | C  |      C  | CG       A  | AT       C  |       CA AT        CG       T  T CG        TA        Ta T  T       TG        Tg TA       T  T       Cg TG       T  T       Ta TA        GC        Ta CG        AT        Gc GT        AT        At GT        GT        Gt                         tattttatacttgtaggtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here [U] COG0552 Signal recognition particle GTPase ... can be seen here [C] COG0633 Ferredoxin ... can be seen here     ..................................................................................................................