                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.91 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAGTCCGTTTATGAAAGTACTGTAATTCAAACCGTAAGCCCTGACTGCCGCGTTT
ATCCTCGCGATCCATAGTCTCCTGAATTCCCTCTTTCTGAGTTTTCTGTCCCTGTACT
GGTAGTACAGGGCTCTCATTACTGCTTCTTTTGCCCTTCTGTAAGATCTGCTCCTCTG
ACCTCTGTAACCTTTAGCCAGTTTAAGGATTTTCTTCTTTTTCCTTCTGGAAGAAGGT
CCCTTTACTCTCATgcgatgcctccttttacgagagaggttattttaacataaaattttaagtctggaATG

    pheA Gene: pheA     GI: 15606269     BI number: aq_951     GOG: COG0077,COG1605     Description: chorismate mutase/prephenate dehydratas TT C  C T  T T  T T  T T  T        C AT       T  T GC       C  C GC       A  A AT       T  T AT       T  g T  |      T  c T  |      C  g T  |      C  a GC       C  t AT        Tg        ta CG        Gc       t  c CG        Gc        tg G  A       At        ta A  A      A  c       cg TG        Gc       |  a TA        At        cg TA        At        ta CG        Gt        cg CG        Gt        cg AT        Ta        gt                         tattttaacataaaattttaagtctggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................