Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=71 nt.     Delta G= -4.17 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTATCGTTGAAAGGACAAACCTGTCGAGTATAACTACTTTATCCCTTTTTAAGTCG
GGGATTATCTTTTCTTCAATGAGTTTTGAGCGGGATGCTTCAAAGAGCAGGAGTTCAG
TCCTTTCGTCTAGCTCTTCCGTAAGTAAAATTTCTCTTAATACTTCTCCAACTTTTGT
TCCGCCGGGCTCCCTGTAAAGGGACACAAAGTAGCCCTTTTGTTTAAGGTACTCATAC
AGTTTTTTCGCCTGTGTAGTCTTTCCCGAACCGTCTATTCCCTCAAAAGCGATTAACA
TataactattATG

    cbbE2


Gene: cbbE2     GI: 15606282     BI number: aq_968     GOG: COG0036     Description: ribulose-5-phosphate 3-epimeras


            C
          T  T
          T  C
          T  T
          A  T
          A  A
          A  A
           AT
           TA
           GC
 TC        AT
T  A       AT
G  G      |  C
 AT       T  T
 GC       G  C
 GC       C  C
 AT       C  A
C  |      T  A       TA
 GT       T  C      G  A
 AT       C  T       TA
 GC       T  T       CG
A  G      C  T       CG
A  T      G  T       CG
A  C      A  G       TA
C  T      T  T      |  C
T  |      C  T      |  A
 TA       T  C      |  C
 CG        GC       |  A
 GC        CG       |  A
|  T      T  C      |  A
T  C      T  C      |  G
 AT       T  |      |  T
 GT        CG       |  A
 GC        CG        CG
 GC        TG        GC
 CG        GC        GC
 GT        AT        GC
                        TTTTGTTTAAGGTACTCATACAGTTTTTTCGCCTGTGTAGTCTTTCCCGAACCGTCTATTCCCTCAAAAGCGATTAACATataactattATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG0036 Pentose-5-phosphate-3-epimerase ... can be seen here

    ..................................................................................................................