                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:92 nt.    Distance to gene:89 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=68 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -5.35 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtct-tcaact. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtctataactattcttgtattgtcaactttcagaaggtaaacccttccgttcttcataagtatttttgcccttttcccctccttcagtcccatggacc
tgagcttttgaattacaggattttcttcgttttcgtatccgagaataagaaattcttttccttcttttaagccctctaccattttctacctcctttcgtg
aaataaagatacaatctcaaaatctttgtgtcaagtccaaagagcattattgtaaaATG

    metG --- aq_1258 --- aq_1259 --- aq_1262 --- aq_1263 --- aq_1264 Gene: metG     GI: 15606482     BI number: aq_1257     GOG: COG0143     Description: methionyl-tRNA synthetase alpha subunit Gene: aq_1258     GI: 15606483     BI number: aq_1258     GOG: COG1477     Description: putative protein Gene: aq_1259     GI: 15606484     BI number: aq_1259     GOG: NOG13070     Description: putative protein Gene: aq_1262     GI: 15606485     BI number: aq_1262     GOG: -------     Description: putative protein Gene: aq_1263     GI: 15606486     BI number: aq_1263     GOG: -------     Description: putative protein Gene: aq_1264     GI: 15606487     BI number: aq_1264     GOG: -------     Description: putative protei             a           c  t            cg            cg            ta           |  c            gc            at            cg            ta            tg           c  c           c  t   a       t  t a  a      c  t t  c      c  t gc       c  | gc        cg at        ta at        ta gc       t  t a  c      t  t c  g      c  a       at t  t      c  |      t  c t  t      c  |       gc t  c       gc        cg c  t       ta        ta a  t       tg        tg a  c       tg        ta c  a       ta        ta t  t      |  t       gt g  a      t  t      c  | ta       a  t       ta tg       t  t       ta at        gc        cg ta        at        ta gt        at        ta                         attcttttccttcttttaagccctctaccattttctacctcctttcgtgaaataaagatacaatctcaaaatctttgtgtcaagtccaaagagcattattgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0143 Methionyl-tRNA synthetase ... can be seen here [H] COG1477 Membrane-associated lipoprotein involved in thiamine biosynthesis ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_aeolicus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:91 nt.    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.30 kcal/mol Antiterminator:    Distance from promoter:59 nt. Size=68 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:    Distance from promoter:41 nt.    Size=48 nt.     Delta G= -6.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtct-tcaact. It has a score value of 66.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtctataactattcttgtattgtcaactttcagaaggtaaacccttccgttcttcataagtatttttgcccttttcccctccttcagtcccatggacc tgagcttttgaattacaggattttcttcgttttcgtatccgagaataagaaattcttttccttcttttaagccctctaccattttctacctcctttcgtg aaataaagatacaatctcaaaatctttgtgtcaagtccaaagagcattattgtaaaATG     metG --- aq_1258 --- aq_1259 --- aq_1262 --- aq_1263 --- aq_1264 Gene: metG     GI: 15606482     BI number: aq_1257     GOG: COG0143     Description: methionyl-tRNA synthetase alpha subunit Gene: aq_1258     GI: 15606483     BI number: aq_1258     GOG: COG1477     Description: putative protein Gene: aq_1259     GI: 15606484     BI number: aq_1259     GOG: NOG13070     Description: putative protein Gene: aq_1262     GI: 15606485     BI number: aq_1262     GOG: -------     Description: putative protein Gene: aq_1263     GI: 15606486     BI number: aq_1263     GOG: -------     Description: putative protein Gene: aq_1264     GI: 15606487     BI number: aq_1264     GOG: -------     Description: putative protei             t           t  c            tt            tt            ac           |  g            gt            gt            at            ct   a        ac c  t      t  g cg       t  t cg       a  a ta       a  t |  c      g  c gc       t  | at        t cg        t ta        t tg       c c  c      g         at c  t      a        t  c t  t      g  |       gc c  t      t  |       cg c  t       c        ta c  |       c        tg cg        a        ta ta        g        ta ta        g        gt |  t      |        c  | |  t      t         ta |  a      a         ta t  c      c         cg ta        c        ta cg        c        ta cg        t        ta                         ttcttttccttcttttaagccctctaccattttctacctcctttcgtgaaataaagatacaatctcaaaatctttgtgtcaagtccaaagagcattattgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0143 Methionyl-tRNA synthetase ... can be seen here [H] COG1477 Membrane-associated lipoprotein involved in thiamine biosynthesis ... can be seen here     ..................................................................................................................