                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAACGGCGACGAAACTGGAAACCAGAGGGTGGGAGTGTTTGTAATGCTCCCACATCA
AAAGTCCGACTACGAACTTTTCATCTCCGTACTTCTCTCCAAGGCCTATAACTCCGAG
AATGTCTTTCACTTGCGAAGGGTATAGTGTTTTTAAATCCTTTTTAAACACTTCTATA
ACTTGATTGAAGTCCTCTTCCGTGAGGGGTTCGGTTTTTAGTTCCTTCTCCTCTTTCT
TTTCTGGTTCTTCTCCGAAGGGAAACTGAATAACCTTTCCCATtactttttagtagtttaatctattt
ATG

    lipA Gene: lipA     GI: 15606552     BI number: aq_1355     GOG: COG0320     Description: Lipoic acid synthetas CC         T T  G      T  A T  T      T  G CG       T  T TA       T  T CG        GC CG        GC TG       C  T G  G      T  T AT       T  | AT        GC GC        GT TG        GC TG        GC AT        AT GT        GC             TTTCTTTTCTGGTTCTTCTCCGAAGGGAAACTGAATAACCTTTCCCATtactttttagtagtttaatctatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0320 Lipoate synthase ... can be seen here     ..................................................................................................................