                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:79 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=71 nt.     Delta G= -9.21 kcal/mol
Anti-antiterminator:    Distance from promoter:15 nt.    Size=42 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TATCTT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTGGAACTTCTAAGGTTTTATCTTCTTTGAGCTTTATAAACTGCCCTTCCTGGG
GGATTTGTGCCTTTCCTTCCCAGTAGTAAACATTTTCAAACGTTGTTTTATTCATcgct
ctcctccgaaagtagagtgtaattttattcattttgaagaagtgtgtcaagttaatttaaaacactttttgatttttgttataaatctctagaggtaaaa
tctttaagtATG

    aq_1510 --- oppC --- aq_1508 --- omt Gene: aq_1510     GI: 15606664     BI number: aq_1510     GOG: COG1414     Description: putative protein Gene: oppC     GI: 15606663     BI number: aq_1509     GOG: COG1173     Description: oligopeptide transport system permease Gene: aq_1508     GI: 15606662     BI number: aq_1508     GOG: COG1721     Description: hypothetical protein Gene: omt     GI: 15606661     BI number: aq_1507     GOG: COG4122     Description: O-methyltransferas             A           C  A           T  A           T  C           T  G           T  T            AT            CG            AT            AT            AT           T  T           G  A           A  T           T  T           G  C           A  A TG       C  T G  C      C  | T  C      C  | T  T      T  | T  T      T  | AT       C  | GC       C  | GC       T  | |  T      T  | |  T      T  | GC       C  | GC       C  | GC        Gc TA        Tg         g C  |       Gc       c  a C  |      T  t      c  a T  |      T  c       ta T  |      T  |       cg C  |       At       c  t C  |       Gc        ta CG        Gc        cg GT        Gt        ta TA        Gc        cg CG        Gc        gt AT        Tg        cg                         taattttattcattttgaagaagtgtgtcaagttaatttaaaacactttttgatttttgttataaatctctagaggtaaaatctttaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1414 Transcriptional regulator ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [R] COG1721 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) ... can be seen here [R] COG4122 Predicted O-methyltransferase ... can be seen here     ..................................................................................................................