                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -4.85 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTTTTAAACCTAATTCCTTCAACGTAGGGATGTATTCCTTCGTTAATCTTCTTTAC
CACTTCTTCGTTTATGTCGTAGAGCAGAACTTCGTGTCCTTTCCTGTCAAGGTGCGTG
GCGAGGGTGTTCCCCACcttcccgcacccagtataaaaaatctcatgaattctaaattataaggggcaggttgaaattttcaacttca
gcgtgtatatttttagacagcacgtcttatattaatcggtttcttaaaaaattcttaacactttcttttaaaaaaatccctaaaaggaggtgaagtATG

    aq_1632 --- aq_1631 --- aq_1630 --- nfo Gene: aq_1632     GI: 15606739     BI number: aq_1632     GOG: COG1509     Description: hypothetical protein Gene: aq_1631     GI: 15606738     BI number: aq_1631     GOG: -------     Description: putative protein Gene: aq_1630     GI: 15606737     BI number: aq_1630     GOG: COG0618     Description: hypothetical protein Gene: nfo     GI: 15606736     BI number: aq_1629     GOG: COG0648     Description: deoxyribonuclease I   C T  C T  C       tg GC       a  a TA       c  a GC       t  t Gc       c  t Gt       t  c At       a  t Gc       a  a C  |      a  a Gc       a  a Gc        at         t T  |       at       t  c G  |       ta       t  a Cg        at       t  a Gc        ta       a  c Ta       g  a       at Gc       a  g       at Gc        cg        gc A  |       cg        ta A  |       cg        tg C  |      |  c       gc T  |      |  a      g  g Gc       a  g       at Ta        cg        cg Cg        gt        gt                         atatttttagacagcacgtcttatattaatcggtttcttaaaaaattcttaacactttcttttaaaaaaatccctaaaaggaggtgaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1509 Lysine 2,3-aminomutase ... can be seen here [R] COG0618 Exopolyphosphatase-related proteins ... can be seen here [L] COG0648 Endonuclease IV ... can be seen here     ..................................................................................................................