                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:160 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.50 kcal/mol
Antiterminator:    Distance from promoter:133 nt. Size=39 nt.     Delta G= -3.56 kcal/mol
Anti-antiterminator:    Distance from promoter:86 nt.    Size=57 nt.     Delta G= -5.01 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACT-GATACT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACTTCTAACCTTTCGTCTCCGATACTTTTCAAGTTTTCAACCATTTCCCTGTCTA
GCTCTATTACGTAGAGTTTTTTCAGGGGATGCTGGAGTAAAACCTTAGTTAAGTTTCC
CGTTCCCCCTCCCACTTCCACGACGGTGTTACCTTCCTCTATATTGAGTTCTTCGGCT
ATCTTTTTCAAAACGCCTTCGGAAACTAAAAGGTGTTGCCCGAAGGATTTTTTCAGTC
TTACCATtaactattaaaataactctATG

    purU --- nfeD --- aq_1822 --- mglA2 --- aq_1824 --- aq_1825 Gene: purU     GI: 15606867     BI number: aq_1818     GOG: COG0788     Description: formyltetrahydrofolate deformylase Gene: nfeD     GI: 15606868     BI number: aq_1820     GOG: COG1030     Description: nodulation competitiveness protein NfeD Gene: aq_1822     GI: 15606869     BI number: aq_1822     GOG: -------     Description: putative protein Gene: mglA2     GI: 15606870     BI number: aq_1823     GOG: COG1100     Description: gliding motility protein MglA Gene: aq_1824     GI: 15606871     BI number: aq_1824     GOG: -------     Description: putative protein Gene: aq_1825     GI: 15606872     BI number: aq_1825     GOG: COG2770     Description: putative protei   T G  T T  A GC GC C  T AT GC C  C A  T        T C  C      T  T C  T      T  C T  A      T  A T  T      C  A C  A      T  A       AA A  T      A  A      A  G C  T      T  C      A  G C  |       CG       T  T CG        GC        CG TA        GC        AT CG       |  T       AT C  T      C  T      |  G C  T      T  C      A  C C  C       TG        GC C  T       CG        GC T  T      |  A       CG T  |       TA        TA GC        TA        TA CG        GC        CG CG        AT        CG                         ATTTTTTCAGTCTTACCATtaactattaaaataactctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0788 Formyltetrahydrofolate hydrolase ... can be seen here [O] COG1030 Membrane-bound serine protease (ClpP class) ... can be seen here [R] COG1100 GTPase SAR1 and related small G proteins ... can be seen here [T] COG2770 FOG: HAMP domain ... can be seen here     ..................................................................................................................