                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -4.46 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -9.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGAGGCTGTTTTAAaggtaaaggagctcttcaatgcaaaaatactcaaagtacgaagtaaaagctaaggtcataaaggtgagaatgcc
cgtggaagagatagggctgtttaacgcactaatagacggcttgcccaggtacgcactcacgaggacgaaggaaaagggaaagggagaagttttcgtttta
gcgactccttataaagtcaaggaattgatggaagctatggagggtatgaaaaaacacataaaggatttagaaatcctcggagagacggatgaggatttaa
ctttttaaagtATG

    uvrB Gene: uvrB     GI: 15606895     BI number: aq_1856     GOG: COG0556     Description: repair excision nuclease subunit ga g  a at at         a cg       c  t ta       a  a gt       c  a |  g      a  a |  g      a  g a  a      a  g a  a      a  a a  g       at t  c       at a  t       gt t  a       ta t  t      |  g       ga cg       |  a      a  c cg       a  a      g  g ta        ta       a  g cg        gt       g  a a  g       gc        gt g  g       gc        cg c  t       at        ta g  a       gc        cg at       g  g       cg tg       t  g       ta ta       a  |       at ta        ta        at ta        cg        at                         aactttttaaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0556 Helicase subunit of the DNA excision repair complex ... can be seen here     ..................................................................................................................