                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-13.36 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTGCCAGCCCAATCGTAGAGCTGGAATATGCCGTGTCTCCTTCCTACAAGAACCCA
GTAGGCGTCTTCGGAAACGTCTAAGGTTTCTATCCAGTACTCCTCTATCTTTGCGTCC
GGATCCCTTTTTAAGGGGAAGTACTTGAACTTCAAATCACCTACGGTGAACTCGGGAG
TTTTTTCTTCTTTCCTTTCTTCCTTTTTAAGGAACTTGTTTAAAATACCCATttaagataa
acatattaaagacttaaaggtgcacgactttctgaggaatctcatactgagttaaaatttccactATG

    aq_2013 --- flhB Gene: aq_2013     GI: 15606999     BI number: aq_2013     GOG: COG0432     Description: hypothetical protein Gene: flhB     GI: 15607000     BI number: aq_2014     GOG: COG1377     Description: flagellar biosynthetic protein Flh            CG           G  T           T  C           T  C            TG            CG            TA            AT           |  C           |  C           |  C           |  T           |  T           |  T           |  T           |  T           |  A            TA            CG            TG            CG            CG           |  A            TA            CG            AT            TA TC        GC         A T  G       AT       T  C CG       C  T       CG TA        CG        CG |  A       TA        AT |  A      |  A       CG GC       |  C       TA CG       |  T      |  A GT       |  T      |  C GC       |  C      A  T AT       A  A      A  C TA       T  A      A  G G  A      C  A       CG A  |      T  T       TG C  |      T  C       TA CG        TA        CG CG        GC        AT AT        GC        AT AT        AT        GT                         TTTCTTCTTTCCTTTCTTCCTTTTTAAGGAACTTGTTTAAAATACCCATttaagataaacatattaaagacttaaaggtgcacgactttctgaggaatctcatactgagttaaaatttccactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0432 Uncharacterized conserved protein ... can be seen here [NU] COG1377 Flagellar biosynthesis pathway, component FlhB ... can be seen here     ..................................................................................................................