Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:64 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-11.30 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=41 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G= -4.86 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tatgtt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgattttcaatctttttagctatgttgcatcatgatttcaatacatcacaccatcaaagcatcacttattaaggttcacttaccatattcaattgccaa
ggagccggagcccaaaaagggctttgtttagtattttaaaacattttcaagttttttccaagcttttgtcagggtttgtttagaaggaaaagttttagaa
tTTG

    hemG


Gene: hemG     GI: 15607001     BI number: aq_2015     GOG: COG1232     Description: protoporphyrinogen oxidas


 aa
c  t
t  a
t  c
 ta
 at
 gc
 ta
|  c
|  a
|  c
a  c
c  a
t  t
a  c       tc
c  a      t  a
g  a      a  a
 ta       t  t
 tg        at
 gc        cg
 ta       c  c        a
 at       a  c      a  a
t  c       ta       a  a
c  a       ta        cg
 gc        cg        cg
 at       a  |       cg
|  t       cg        gc
t  a       ta        at
t  t       tg        gt
t  t       gc        gt
 ta        gc       c  |
 ta       a  g       cg
 cg       a  g       gt
 tg        ta        at
 at        tg        gt
                        agtattttaaaacattttcaagttttttccaagcttttgtcagggtttgtttagaaggaaaagttttagaatTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG1232 Protoporphyrinogen oxidase ... can be seen here

    ..................................................................................................................