Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.30 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G= -7.95 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGTATGCCTCTGTATAGTTTTTAAAACTCTTACGGGGTTTCCAACTCTTACTACTT
TTACATTTTCCCTTACAAGTCTTTCCACGAGGTTGTCAACCGCAACGTTTGAGTCGGC
GGTAGCGAGGACTTTATAACCTTCTTGTGCAAGCCTTTTTATGCATTCCACTAAAGTG
GTGGTTTTTCCCGTTCCGGGAGGACCGTGTATGAGGAATACTTTTTCGGCTTTTAAAG
CCCTTTCAACTGCCTTTTTCTGATACGCGTTGAGTTTTGTCATTCCTGATTTATATAC
TAAAACACTGATG

    aas


Gene: aas     GI: 15607028     BI number: aq_2058     GOG: COG0204     Description: 2-acylglycerophosphoethanolamine acyltransferas


  C
C  C
T  T
T  T
T  A
T  C
A  A
C  A
A  G
T  T
T  C
T  T
T  T
C  T
A  C
T  C       TT
C  A      T  G
A  C      G  A
 TG        CG
 TA        AT
 CG       |  C       AT
T  |      A  G      T  A
 CG        CG       T  A
 AT        GC       T  C
 AT        CG       C  C
 CG        CG        AT
C  T       AT        GT
T  C      |  A       GC
 TA       |  G       AT
 TA       A  C       GT
 GC        CG        CG
 GC        TA        GT
|  G      G  G      A  G
|  C       TG       T  C
|  A       TA       G  A
G  A       GC       G  A
 GC        GT        CG
 CG        AT        GC
 AT        GT        GC
                        TTTTTATGCATTCCACTAAAGTGGTGGTTTTTCCCGTTCCGGGAGGACCGTGTATGAGGAATACTTTTTCGGCTTTTAAAGCCCTTTCAACTGCCTTTTTCTGATACGCGTTGAGTTTTGTCATTCCTGATTTATATACTAAAACACTGATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[I] COG0204 1-acyl-sn-glycerol-3-phosphate acyltransferase ... can be seen here

    ..................................................................................................................