                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-11.51 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGGATTGAGTTATTACTTTGTACGCACCCACCAAATCACCTTCCGTTATTTTCTTT
ATAAAGCCGGGAATGTCCACGTGAACGGGACAGCCCTTTATGCACCTCTGTTCGGCGT
CTTTACAAAATAAACAGCGCTGTGCCTCGTCAAGGGCTAAATTTACGGAGTATCCGAG
TTCAAACTCCCTGAAGGTTTTTACCCTTTCTTCTGGCGGGAGAGTGGGTTCTTTATTC
CTGTCAAGGTAGCGAATCTTCTTTGCCATaggttaagatgataaactctcctttaagatattcaagttATG

    aq_2066 --- aq_2067 --- argB --- obg --- aq_2071 --- aq_2073 --- murD Gene: aq_2066     GI: 15607033     BI number: aq_2066     GOG: COG1238     Description: hypothetical protein Gene: aq_2067     GI: 15607034     BI number: aq_2067     GOG: COG0011     Description: hypothetical protein Gene: argB     GI: 15607035     BI number: aq_2068     GOG: COG0548     Description: acetylglutamate kinase Gene: obg     GI: 15607036     BI number: aq_2069     GOG: COG0536     Description: GTP-binding protein Gene: aq_2071     GI: 15607037     BI number: aq_2071     GOG: COG1092     Description: hypothetical protein Gene: aq_2073     GI: 15607038     BI number: aq_2073     GOG: COG0053     Description: putative protein Gene: murD     GI: 15607039     BI number: aq_2075     GOG: COG0771     Description: UDP-N-acetylmuramoylalanine-D-glutamate ligas   T G  A A  T GC GC CG |  A A  G T  T T  T T  C A  A A  A A  A T  C C  T        A         G GC       T  C      G  C GC       T  C      T  G GC       T  C       CG A  |      T  T       TG AT       T  T       TA CG        GT        CG TA        GC        TA G  |       AT        TG C  |       AT       T  T TA        GC        CG CG       T  T       CG CG        CG        CG GT        CG        AT                         TCTTTATTCCTGTCAAGGTAGCGAATCTTCTTTGCCATaggttaagatgataaactctcctttaagatattcaagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1238 Predicted membrane protein ... can be seen here [S] COG0011 Uncharacterized conserved protein ... can be seen here [E] COG0548 Acetylglutamate kinase ... can be seen here [R] COG0536 Predicted GTPase ... can be seen here [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here [P] COG0053 Predicted Co/Zn/Cd cation transporters ... can be seen here [M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here     ..................................................................................................................