                                                                        Gene putatively regulated by attenuation in A_aeolicus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.52 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAGAACTCACGGAAGAGGCAAAGAAAGAACTCGTAAGGAGAGGATACGACCCGGCAT
TCGGAGCGAGACCTCTAAAGAGAACAATTCAGAAGTACGTGGAAACACCCCTCGCGGA
CAAGATAATAAGAGGAGAAATCAAGGACGGAATGACGGTAGTTGTGGACTACAAAGAC
GGGGAGTTCGTCTTTATTCCTAAGGAAGAGTACGAAAAACAGAAAGCTGAGGTTTCCG
CATCCTCCGAAGAGAAGAAGGAATCCTAAaccttctcctttttcttttttataattttttatactcaaCGG

    _v30 Gene: _v30     GI: _v30     BI number: _v30     GOG: -------     Description: tRNA-Pr AA A  G GC AT CG                   A |  A       GA       A  a A  G      C  A      T  c A  G       CG       C  c AT        TA       C  t AT        CG       T  t AT       C  A      A  c GC       T  A       At C  C      A  G       Gc A  G      C  A       Gc T  C      G  A       At G  A       CG        At AT        CG        Gt GC        TA        At A  C       TA        At AT       T  T       Gc GC        GC        At GC        GC        Gt                         ttttataattttttatactcaaCGG     ..................................................................................................................