                                                                        Gene putatively regulated by attenuation in A_aeolicus_pl-ece1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-15.60 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=44 nt.     Delta G= -9.29 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=14 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttagt-tatctt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttagttctcctagaaacatttatatctttttccatatacaaaagctttttgttattggagaagtaataagttatataggagaactctcctttcaagttt
ttgattttcaatatagttctcctatatataggagaacttttgtgattttttctattctgtaatgcccgatttttagtttggtcataagtggttctcctag
aactaggagaaccgacaaagcaaaaaaatagataaaatcgaggaatgcgacactaaaatagtttttaggacATG

    aq_aa34 Gene: aq_aa34     GI: 10957067     BI number: aq_aa34     GOG: -------     Description: putative protei            tt           g  t            at            at            cg            ta        at           |  t      t  a           |  t       at           |  t       ta           |  t       cg           t  c       cg           t  a       ta           c  a       cg           c  t       ta           t  a       ta           c  t       gc            ta        at ac        cg       t  t a  t       at       a  t gc        at       t  t at        gc       a  g gc        at        at gc        gc        cg at        gc        ta                         ttttttctattctgtaatgcccgatttttagtttggtcataagtggttctcctagaactaggagaaccgacaaagcaaaaaaatagataaaatcgaggaatgcgacactaaaatagtttttaggacATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_aeolicus_pl-ece1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:86 nt.    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.40 kcal/mol Antiterminator:    Distance from promoter:49 nt. Size=44 nt.     Delta G= -9.29 kcal/mol Anti-antiterminator:    Distance from promoter:11 nt.    Size=14 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttagt-tatctt. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttagttctcctagaaacatttatatctttttccatatacaaaagctttttgttattggagaagtaataagttatataggagaactctcctttcaagttt ttgattttcaatatagttctcctatatataggagaacttttgtgattttttctattctgtaatgcccgatttttagtttggtcataagtggttctcctag aactaggagaaccgacaaagcaaaaaaatagataaaatcgaggaatgcgacactaaaatagtttttaggacATG     aq_aa34 Gene: aq_aa34     GI: 10957067     BI number: aq_aa34     GOG: -------     Description: putative protei            tt           g  t            at            at            cg            ta           |  t           |  t           |  t           |  t           t  c           t  a           c  a           c  t       at           t  a      t  a           c  t       at            ta        ta tt        cg        cg c  t       at        cg gt        at        ta at        gc        cg ag        at        ta at        gc        ta at        gc        gc                         ttttgtgattttttctattctgtaatgcccgatttttagtttggtcataagtggttctcctagaactaggagaaccgacaaagcaaaaaaatagataaaatcgaggaatgcgacactaaaatagtttttaggacATG     ..................................................................................................................