                                                                        Gene putatively regulated by attenuation in A_aeolicus_pl-ece1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=2 nt.   Size=20 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-15.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAGACTTAATACTTTTAACGAAAAAGATTAAAGAAAAGGTAACGAAAACAACATG
Aagtcaacaagctcatactaaaggtgcaaacttgaatctggaagattttactaatgggagaaagtgtcgcttccgttgtaaatgaacctttacaacttcg
cttcttagttctcctgaattcgggataatttttgttgtcctagttcttttgttaacatttttcccaagggaagtttaaatcaccgtatcagcttattagg
tatcttgaatttcaatcagttacgattaacttaaaagatacgATG

    aq_aa38 Gene: aq_aa38     GI: 10957070     BI number: aq_aa38     GOG: COG3177     Description: putative protei aa g  c t  c at at at ta gc ta ta gc c  t c  t t  c t  | cg gc |  t c  t t  c       at g  t      a  t t  t       gc        tt g  a       tg       t  t a  g       cg        tg at        cg        at at        ta        at gc       c  t       tg at        ta        at gc        ta        gc gc        gt        gc gt        at        gt                         agttcttttgttaacatttttcccaagggaagtttaaatcaccgtatcagcttattaggtatcttgaatttcaatcagttacgattaacttaaaagatacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3177 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_aeolicus_pl-ece1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-10.20 kcal/mol Antiterminator: Size=24 nt.     Delta G= -6.40 kcal/mol Anti-antiterminator:   Size=22 nt.     Delta G= -5.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTAAAGACTTAATACTTTTAACGAAAAAGATTAAAGAAAAGGTAACGAAAACAACATG Aagtcaacaagctcatactaaaggtgcaaacttgaatctggaagattttactaatgggagaaagtgtcgcttccgttgtaaatgaacctttacaacttcg cttcttagttctcctgaattcgggataatttttgttgtcctagttcttttgttaacatttttcccaagggaagtttaaatcaccgtatcagcttattagg tatcttgaatttcaatcagttacgattaacttaaaagatacgATG     aq_aa38 Gene: aq_aa38     GI: 10957070     BI number: aq_aa38     GOG: COG3177     Description: putative protei                      tt                     t  t                      tg                      at            ac        at aa       a  t       tg g  c       ct        at t  c       ac        gc at        tg        gc at        tc        gt at        tt       c  | ta       c  t       ta gc        cc        tg ta        at        at ta        at        at gc        ga        gc                         ttttgttaacatttttcccaagggaagtttaaatcaccgtatcagcttattaggtatcttgaatttcaatcagttacgattaacttaaaagatacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3177 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................