                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=73 nt.     Delta G= -8.86 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTGAGGAAATACTCACAACTATGGAGTTTGCCGGAGCCGGCACATTTGCCAGAGTG
GGAGATAAAGAGTACATCTTCAACACCTATGCTGAGTCAACGGCCATAACCAAGCTTA
TAATTTCGTCGGTTTTGGCTTCCGCAGGCTTAAAGGTCGAGATAGACCACACTCCCGG
CAAGATTTTCATAAGACTTTAGccaaatcaagttattttaatcaaaagtcagataattttgttatgaactgattcataacagct
tttatctttagaaggcctattttctaatttggaggtgtttagATG

    mtaC --- 1 Gene: mtaC-1     GI: 11497627     BI number: AF0006     GOG: COG5012     Description: corrinoid methyltransferase protein (mtaC-1) Gene: AF0007     GI: 11497628     BI number: AF0007     GOG: -------     Description: hypothetical protei            gt           a  t           a  a           c  t           t  t           a  t CT       a  t A  C      a  a C  C      c  a A  C      c  t CG       G  c CG       A  a |  C       Ta A  A       Ta G  A       Ta A  G       Cg TA        At AT        Gc GT       A  a AT       A  | GT       T  | |  C      A  | |  A       Cg |  T       Ta |  A      T  t |  A       Ta CG        Ta        tg TA        At       c  a GC        Gt        at GT        At        at AT        At        gc AT        Cg        ta A  |       Gt        at T  |       Gt        ta TA       C  a       ta CG       C  t       gc Gc        Cg        ta Gc        Ta        tg                         cttttatctttagaaggcctattttctaatttggaggtgtttagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5012 Predicted cobalamin binding protein ... can be seen here     ..................................................................................................................