                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:31 nt.    Distance to gene:157 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=28 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G= -6.99 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaatt-taaact. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaattacaaaaacaaaatttattaaactaaaattcgatgaggactttctgaacaattcggttggctccgaacaattcggaattaatcgaatttttaata
tattttcgaaaacaaaaattttataatacgcatgttagctcactgaattcagactatttccagcctttccaaaacgagtttgtaaacgtttgaattattc
cccctaaaccaaatgttagggtttgcgacacttcacaaaagttaaatatccgatatgaacagcaATG

    AF0094 --- cysT --- cysA Gene: AF0094     GI: 11497714     BI number: AF0094     GOG: COG0725     Description: conserved hypothetical protein Gene: cysT     GI: 11497713     BI number: AF0093     GOG: COG0555     Description: sulfate ABC transporter, permease protein (cysT) Gene: cysA     GI: 11497712     BI number: AF0092     GOG: COG3839     Description: sulfate ABC transporter, ATP-binding protein (cysA aa c  a a  a a  t a  t a  t a  a c  t a  t t  a t  a a  a a  c t  t ta ta ta ta at at gc cg ta gt         a a  g      c  a        a a  a       at       c  a a  g       at        at tg        gc        at ta        tg        gc t  c       cg        cg a  t      t  t       cg c  t      t  t       ta at        tg       c  a gc        cg        gt |  t      |  c       gt cg        at        ta ta        gc        ta ta        gc        gt                         cgaatttttaatatattttcgaaaacaaaaattttataatacgcatgttagctcactgaattcagactatttccagcctttccaaaacgagtttgtaaacgtttgaattattccccctaaaccaaatgttagggtttgcgacacttcacaaaagttaaatatccgatatgaacagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0725 ABC-type molybdate transport system, periplasmic component ... can be seen here [O] COG0555 ABC-type sulfate transport system, permease component ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.00 kcal/mol Antiterminator: Size=28 nt.     Delta G= -6.50 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -5.99 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cgattattgatttattcgacatttaaagtcgaatttttaattacaaaaacaaaatttattaaactaaaattcgatgaggactttctgaacaattcggttg gctccgaacaattcggaattaatcgaatttttaatatattttcgaaaacaaaaattttataatacgcatgttagctcactgaattcagactatttccagc ctttccaaaacgagtttgtaaacgtttgaattattccccctaaaccaaatgttagggtttgcgacacttcacaaaagttaaatatccgatatgaacagca ATG     AF0094 --- cysT --- cysA Gene: AF0094     GI: 11497714     BI number: AF0094     GOG: COG0725     Description: conserved hypothetical protein Gene: cysT     GI: 11497713     BI number: AF0093     GOG: COG0555     Description: sulfate ABC transporter, permease protein (cysT) Gene: cysA     GI: 11497712     BI number: AF0092     GOG: COG3839     Description: sulfate ABC transporter, ATP-binding protein (cysA aa c  a a  a a  t a  t a  t a  a                  a c  t                c  a a  t                 at t  a        g        at t  a      t  a       gc a  a       ag        cg a  c       gg        cg t  t       ca        ta ta        tc       c  a ta        tt        gt ta       a  t       gt ta       a  t       ta at        ac        ta at        at        gt gc       |  g       gc cg        ta        cg ta        ca        ta gt        ac        ta                         tttttaatatattttcgaaaacaaaaattttataatacgcatgttagctcactgaattcagactatttccagcctttccaaaacgagtttgtaaacgtttgaattattccccctaaaccaaatgttagggtttgcgacacttcacaaaagttaaatatccgatatgaacagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0725 ABC-type molybdate transport system, periplasmic component ... can be seen here [O] COG0555 ABC-type sulfate transport system, permease component ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here     ..................................................................................................................