                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.29 kcal/mol
Antiterminator:    Distance from promoter:38 nt. Size=36 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttgga-tacaat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttggatgagttcatttattggtacaattacgttaagcctcacatgagcctgaattttgatgaactggagactccttaccaagcttttctgaggaagcta
cctgctgaaagggtgtttgagtacgggaggtggttgtttgaggagtgaaattatttcgggatatcacagaaaaacttattttgacaaaaagttaaagttt
tcATG

    AF0194 --- AF0195 Gene: AF0194     GI: 11497810     BI number: AF0194     GOG: -------     Description: hypothetical protein Gene: AF0195     GI: 11497811     BI number: AF0195     GOG: -------     Description: hypothetical protei   c g  t       gt a  t      t  t a  t      g  t c  t      g  g c  c      g  a at       a  g tg       a  t ta       a  a cg        gc cg        tg ta        cg c  a      g  g a  g       ta gc        cg at        cg |  a       at gc        tg gc        cg             ttgtttgaggagtgaaattatttcgggatatcacagaaaaacttattttgacaaaaagttaaagttttcATG     ..................................................................................................................