                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAACCTATAAAGGCGTAAAGAAACTCGATCAACTTCACCACCTCTTAATCGTCAAGT
ATGTAAGGTATGCAGCAGTTACAGCAGTCCAGTAAAGGTAAGTGGTCATGTCATGGCT
TCTTATCGCAACAAACGGAACCAGCATGGCAGCAATAACCACaattccttcaagcagcttcatcgaaca
tatgttcgagaagttgtttttattgtttttggttgtgctgtttatgggagactggggatttgaaattagcggacaccttttaaactataaataccgcagc
agcctataaaccaacATG

    htpX --- AF0234 Gene: htpX     GI: 11497851     BI number: AF0235     GOG: COG0501     Description: heat shock protein (htpX) Gene: AF0234     GI: 11497850     BI number: AF0234     GOG: COG0491     Description: conserved hypothetical protei            GG           T  C           A  A            CG            GC   T       A  A G  C      C  A TA       C  T AT       A  A CG       A  A TG        GC GC        GC GT       C  A T  T      A  C GC       A  a AT       A  a AT       C  t       ta TA       A  t      a  t GT       A  c       cg GC       C  c       at A  G      G  t       at A  C      C  t       gc A  A      T  c       cg TA       A  |       ta GC        Ta       a  | |  A       Ta        cg |  A       Cg        ta |  A      T  c       ta A  C       Ta        cg CG        Cg        gt CG        Gc        at TA        Gt        cg                         tttttattgtttttggttgtgctgtttatgggagactggggatttgaaattagcggacaccttttaaactataaataccgcagcagcctataaaccaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0501 Zn-dependent protease with chaperone function ... can be seen here [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.00 kcal/mol Antiterminator: Size=63 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTAACCTATAAAGGCGTAAAGAAACTCGATCAACTTCACCACCTCTTAATCGTCAAGT ATGTAAGGTATGCAGCAGTTACAGCAGTCCAGTAAAGGTAAGTGGTCATGTCATGGCT TCTTATCGCAACAAACGGAACCAGCATGGCAGCAATAACCACaattccttcaagcagcttcatcgaaca tatgttcgagaagttgtttttattgtttttggttgtgctgtttatgggagactggggatttgaaattagcggacaccttttaaactataaataccgcagc agcctataaaccaacATG     htpX --- AF0234 Gene: htpX     GI: 11497851     BI number: AF0235     GOG: COG0501     Description: heat shock protein (htpX) Gene: AF0234     GI: 11497850     BI number: AF0234     GOG: COG0491     Description: conserved hypothetical protei gc a  a a  g cc tt t  t c  c c  a t  t t  c ag aa C  a A  c C  a       ta C  t      a  t A  a       cg A  t       at T         at A         gc A         cg C         ta G        a  | A  |       cg C        ta G        ta G        cg T         gt A        at C        cg G        gt A        at             tttattgtttttggttgtgctgtttatgggagactggggatttgaaattagcggacaccttttaaactataaataccgcagcagcctataaaccaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0501 Zn-dependent protease with chaperone function ... can be seen here [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................