                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTGTCGATAATCTCCAGATCACCAAGTTTGGCAACGGCAATGTCGACTGTTGTGCCG
GGGTAGTTGGAAATGGTCGCATACTTCCCGGTGAGGGCGTAAAATAGAGCGCTTTTCC
CCACATTGGGGTTCCCCACGAGCGCCACCTTTTTTTCTGCAGTGACGGTTTCCGCTTT
AACACTGTGACATTCCATtggtttttaggctaacctaaattatttaaaggttttggtcaaaaaattcaaaaccgattttttaataca
gaaaattaaagttattaacaacttagccctaagcaagctGTG

    AF0247 Gene: AF0247     GI: 11497863     BI number: AF0247     GOG: COG1524     Description: hypothetical protei ta c  a gc gc at ta ta ta |  t |  t t  a t  t        a gt       a  a gt       a  a ta       c  a Ta       t  t A  a       gt Cg        gc Cg        ta |  t       ta T  t       ta T  t       ta At        gc Cg        gc             gattttttaatacagaaaattaaagttattaacaacttagccctaagcaagctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1524 Uncharacterized proteins of the AP superfamily ... can be seen here     ..................................................................................................................