                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gattataatcgcgggagtgatgattagggataaaacgtaggcaacagcgcaggaaacgaggggcagaagccatcacaacgaaaccaaccaatagctagaa
tgtaaccgagaagcagaatcaggccgctgagataaaggtagttgagaagaacgttcgtgatcgacccctctttcaggctaattgcgccagggggaaaagt
agcccaagaatcatggcggtgatgaaaaccgccgaggagtttcttagcatatcactcttagtcgccaaacttttttaacacctgtgccaaaactgccgac
GTG

    AF0372 --- AF0371 --- eif2BD --- AF0369 Gene: AF0372     GI: 11497984     BI number: AF0372     GOG: COG1526     Description: conserved hypothetical protein Gene: AF0371     GI: 11497983     BI number: AF0371     GOG: COG1059     Description: conserved hypothetical protein Gene: eif2BD     GI: 11497982     BI number: AF0370     GOG: COG0182     Description: translation initiation factor eIF-2B, subunit delta (eif2BD) Gene: AF0369     GI: 11497981     BI number: AF0369     GOG: -------     Description: hypothetical protei            ag           a  t           a  a           a  g            gc            gc            gc           |  a   t       |  a a  t      |  g a  g      |  a t  c      |  a        g cg       |  t      t  a gc       g  c      a  a gc       g  a      g  a a  |       at        ta c  |       cg        gc t  |       cg        gc t  |       gc        cg ta       |  g       gc cg        cg        gc tg        gt        tg cg        tg       a  a cg        ta        cg cg        at        tg                         agtttcttagcatatcactcttagtcgccaaacttttttaacacctgtgccaaaactgccgacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1526 Uncharacterized protein required for formate dehydrogenase activity ... can be seen here [L] COG1059 Thermostable 8-oxoguanine DNA glycosylase ... can be seen here [J] COG0182 Predicted translation initiation factor 2B subunit, eIF-2B alpha/beta/delta family ... can be seen here     ..................................................................................................................