                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=71 nt.     Delta G=-21.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACACCCTCGGCAACGATTTTAATTGCCTTTATGAAGCTTTCAAGCTCGTTCTGCTTC
GGGATGGCGTGAAAGTAAATCTCGGAGTTATCTATCTTTACTCCGGGAAGAGACAGCC
TGGGCTCGGGATTGGGGTTGAACTCGAGGGTGATTTTTTCCTCATCCTCGAAAAGCTT
TTTAAGGTAATCGTAAATCTCCCTGCTGTTGAAAACTCTGAGCCTGATACTTCTCTTC
AGCTCGTCCAGTCGCATcaagcgcagtgcagcaacaagttttaaagcattttttgatatctctctataATG

    AF0516 --- cdc21 --- AF0518 --- AF0519 --- AF0520 Gene: AF0516     GI: 11498127     BI number: AF0516     GOG: -------     Description: hypothetical protein Gene: cdc21     GI: 11498128     BI number: AF0517     GOG: COG1241     Description: cell division control protein 21 (cdc21) Gene: AF0518     GI: 11498129     BI number: AF0518     GOG: COG0467     Description: conserved hypothetical protein Gene: AF0519     GI: 11498130     BI number: AF0519     GOG: COG1617     Description: hypothetical protein Gene: AF0520     GI: 11498131     BI number: AF0520     GOG: COG1685     Description: conserved hypothetical protei   A T  T C  C T  T A  T T  T TA GC AT GC GC CG TG CG TA |  A A  G       TG A  A      T  G A  G      A  G TA       G  G       TT GC        GT       T  T A  A       GT       T  C A  |       CG       T  C A  |       TA        AT G  |      C  A       GC T  |       GC        TA G  |       GT        GT CG        GC        GC GC       |  G       GC GC        TA        AT |  T       CG        GC |  G       CG        CG T  G      G  G       TA A  G       AT       C  A GC        CG       A  A GT       |  A      A  | GC        AT       G  | CG        GT        TA TG        AT        TG TG        GT        GC                         TTTTTAAGGTAATCGTAAATCTCCCTGCTGTTGAAAACTCTGAGCCTGATACTTCTCTTCAGCTCGTCCAGTCGCATcaagcgcagtgcagcaacaagttttaaagcattttttgatatctctctataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1241 Predicted ATPase involved in replication control, Cdc46/Mcm family ... can be seen here [T] COG0467 RecA-superfamily ATPases implicated in signal transduction ... can be seen here [S] COG1617 Uncharacterized conserved protein ... can be seen here [EH] COG1685 Archaeal shikimate kinase ... can be seen here     ..................................................................................................................