                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGAGAGTCATTGCAGCGTGGGTGTGGGTGTTGAAGAAGCCGGGAATAACAGCTTTC
CTGCTGCCGTCAATGACGACATCGCTCTTCACAGCCTTACCGCCTATTTCGGAAATCT
TTTTCCCTTCAACCTTCAGATTTCCCTCCACAATTCCCTTGGGAGTCAAAATCTTGGC
ATTCTTGATGAGAATCATtggccattatcctgactgctgggataaaattcttttgtcctctttattactgccatgaatttaacactg
accaaaaattattaatactcatagcatcttaacaacgttATG

    thrC --- 1 --- AF0552 --- thiF Gene: thrC-1     GI: 11498161     BI number: AF0551     GOG: COG0498     Description: threonine synthase (thrC-1) Gene: AF0552     GI: 11498162     BI number: AF0552     GOG: COG1977     Description: conserved hypothetical protein Gene: thiF     GI: 11498163     BI number: AF0553     GOG: COG0476     Description: thiamine biosynthesis protein (thiF) Gene: AF0554     GI: 11498164     BI number: AF0554     GOG: COG0425     Description: conserved hypothetical protei AG G  A TA AT GC TA T  T C  t T  g T  | A  | Cg Gc Gc Ta         t         t T  t      c  g      t  c C  t      a  c       at Ta       g  t       at At        tg        at A  c       cg        at A  c       cg        tg At        ta        at Cg        at        gc Ta        ta        gc Gc        ta        gt                         ctttattactgccatgaatttaacactgaccaaaaattattaatactcatagcatcttaacaacgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0498 Threonine synthase ... can be seen here [H] COG1977 Molybdopterin converting factor, small subunit ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [O] COG0425 Predicted redox protein, regulator of disulfide bond formation ... can be seen here     ..................................................................................................................