                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAGCTCAAGCTTGAGGAGATGAAAAGCGGGGAGATTCTTAGGGTTATCATTGACCA
TGAGCCTGCAGTGAGAGACGTGCCGAGGAGCGTGGAGCAGGAGGGGCATGAGGTTCTT
TCAGTGGAAAAGGTAGGAGAGAAAGAATGGAGTATTCTTATAAAAAAGAAGTAAaagctt
tttgaatatttttataaaagctttttaacaccgttaaattttcagggagcagtttttcacgaaattatcaaaacctcgcaaagctatttaagaaataaga
gtgatagttcagtgaggtgatgttATG

    AF0554 --- AF0555 --- AF0556 --- AF0557 --- AF0558 Gene: AF0555     GI: 11498165     BI number: AF0555     GOG: COG2210     Description: hypothetical protein Gene: AF0556     GI: 11498166     BI number: AF0556     GOG: COG0425     Description: conserved hypothetical protein Gene: AF0557     GI: 11498167     BI number: AF0557     GOG: COG0446     Description: flavoprotein reductase Gene: AF0558     GI: 11498168     BI number: AF0558     GOG: COG2427     Description: conserved hypothetical protein Gene: AF0559     GI: 11498169     BI number: AF0559     GOG: COG1606     Description: conserved hypothetical protei CA T  T AT         G TG       A  A TA       G  G GC        TA GC        GC         G G  A      |  G      T  G AT        AT       G  A TG        CG        CG TA        GC        GC CG       |  C      |  A T  |      |  G      A  G T  |       TA       G  G A  |       CG       G  A G  |       CG       A  G A  |      G  A      G  G G  |      A  G       CG GC        GC        CG GC        TG        GC GT        AT        TA CG        CG        GT GC        CG        CG                         AGGTTCTTTCAGTGGAAAAGGTAGGAGAGAAAGAATGGAGTATTCTTATAAAAAAGAAGTAAaagctttttgaatatttttataaaagctttttaacaccgttaaattttcagggagcagtttttcacgaaattatcaaaacctcgcaaagctatttaagaaataagagtgatagttcagtgaggtgatgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2210 Uncharacterized conserved protein ... can be seen here [O] COG0425 Predicted redox protein, regulator of disulfide bond formation ... can be seen here [R] COG0446 Uncharacterized NAD(FAD)-dependent dehydrogenases ... can be seen here [S] COG2427 Uncharacterized conserved protein ... can be seen here [R] COG1606 ATP-utilizing enzymes of the PP-loop superfamily ... can be seen here     ..................................................................................................................