                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=71 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTGGATGGCTCCTGAAATGCTCCTTTTCAACCTCATCGCAGAACTGGAGCATTTCT
TCGTAAATAATATCTCCACACTTCCTCTCGCCCTCGCTGCCCGCAAGCCTCGGCCCGC
ACTCTCTGCAGAGTTTTTGGATGAATTCAATGGGGGAGTTTTGCATgttcgaaatggtttacaaat
tattaatttttgttgttttggactgctgaacctttttttcgaaaggtgttatagatgtttatagcaactttcatttttgaaacataacttttttactgca
atggagtaaaaactctcgATG

    AF0579 --- xthA --- AF0581 --- AF0582 --- AF0583 --- AF0584 --- AF0585 --- AF0586 Gene: AF0579     GI: 11498187     BI number: AF0579     GOG: COG0642,COG2202     Description: hypothetical protein Gene: xthA     GI: 11498188     BI number: AF0580     GOG: COG0708     Description: exodeoxyribonuclease III (xthA) Gene: AF0581     GI: 11498189     BI number: AF0581     GOG: COG0392,COG0463     Description: dolichol-P-glucose synthetase, putative Gene: AF0582     GI: 11498190     BI number: AF0582     GOG: COG5427     Description: hypothetical protein Gene: AF0583     GI: 11498191     BI number: AF0583     GOG: COG5427     Description: hypothetical protein Gene: AF0584     GI: 11498192     BI number: AF0584     GOG: COG1522     Description: transcriptional regulatory protein, AsnC family Gene: AF0585     GI: 11498193     BI number: AF0585     GOG: -------     Description: hypothetical protein Gene: AF0586     GI: 11498194     BI number: AF0586     GOG: -------     Description: hypothetical protei   t t  a a  a t  t t  t at at at cg at t  t t  | t  | g  | g  | tg at at at gt cg tg ta gc        tt        tg T  |      t  c      a  t At        tg        gt Cg        ta        at Gc        ta        ta T  t       ta        at Tg        cg        ta Ta        cg        tg Ta        at        gc Gc       a  g       ta A  |      g  t      g  a Gc       t  t       gc Gt       c  a       at Gt        gt        at Gt        ta        at Gt        cg        gc                         atttttgaaacataacttttttactgcaatggagtaaaaactctcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here [L] COG0708 Exonuclease III ... can be seen here [S] COG0392 Predicted integral membrane protein ... can be seen here [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here [S] COG5427 Uncharacterized membrane protein ... can be seen here [S] COG5427 Uncharacterized membrane protein ... can be seen here [K] COG1522 Transcriptional regulators ... can be seen here     ..................................................................................................................