                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:58 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-12.10 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=18 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AAAAAT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATATCCCTCCCCATTTCAAAAATGGCGGTGTTAAGCTTTCCTGCAAGCTTGTA
AGCGGCGAACATCCCTCCAGGTCCTGCCCCTACAATTATGACGTCAAATTTCATacattt
tgagcttagtggctggaggccttttaagctttgttgttttgtagttgaatgtcacaaacacggtaaaggtttttaatatgctaagagaaaacaagtattg
GTG

    AF0653 Gene: AF0653     GI: 11498261     BI number: AF0653     GOG: COG1733     Description: conserved hypothetical protei             g           g  a           t  g            cg            gc            gc           |  t ag       t  t t  t       gt tg        at cg        ta gc        ta at        cg g  g       gc tg        at ta        gt             tgttgttttgtagttgaatgtcacaaacacggtaaaggtttttaatatgctaagagaaaacaagtattgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1733 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:93 nt.    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.20 kcal/mol Antiterminator:    Distance from promoter:57 nt. Size=18 nt.     Delta G= -4.00 kcal/mol Anti-antiterminator:    Distance from promoter:30 nt.    Size=31 nt.     Delta G= -4.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAA-AAAAAT. It has a score value of 70.95 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAATATCCCTCCCCATTTCAAAAATGGCGGTGTTAAGCTTTCCTGCAAGCTTGTA AGCGGCGAACATCCCTCCAGGTCCTGCCCCTACAATTATGACGTCAAATTTCATacattt tgagcttagtggctggaggccttttaagctttgttgttttgtagttgaatgtcacaaacacggtaaaggtttttaatatgctaagagaaaacaagtattg GTG     AF0653 Gene: AF0653     GI: 11498261     BI number: AF0653     GOG: COG1733     Description: conserved hypothetical protei   C T  C C  A CG                   g CG                 g  a T  T                t  g A  C                 cg C  C                 gc A  |       TT        gc A  |      A  A      |  t GT        AT       t  t CG        CG        gt GC        AA        at GC        TC        ta C  C      C  G       ta GC        CT        cg AT        CC        gc                         tttgttgttttgtagttgaatgtcacaaacacggtaaaggtttttaatatgctaagagaaaacaagtattgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1733 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................