                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:21 nt.    Distance to gene:67 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=16 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGC-TACGTT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGCTGCCAGATGGAATGACCTACGTTCAGGAGCTGCTGGCTGACAAGGGAAGAGA
CCCTTCAGGGCTTTTCTGAtttttccccattaacattgaccgaaatgtgagaaatttttaaatggtttgatatttaatttctcaga
aagagGTG

    AF0689 Gene: AF0689     GI: 11498297     BI number: AF0689     GOG: -------     Description: hypothetical protei   C C  T A  A GC TG AT AT GC |  A |  G G  G T  A A  G GC AT CG                  TC C  C                T  A G  T                 CG TG                  CG CG                  CG GC        GA       A  | AT       A  G       GC |  G      A  A       AT |  A       GC        GT GC        GC        AT TA        GC        AT TA        AT        GC CG        AT        GT                         GAtttttccccattaacattgaccgaaatgtgagaaatttttaaatggtttgatatttaatttctcagaaagagGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.40 kcal/mol Antiterminator: Size=36 nt.     Delta G= -9.60 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G=-11.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCTGCATGCTCCGCTGCCCGATGAAGGCAATAAAGGCAAAGATTAACAGAGAGCCAG CCAGCGTCGATGCTGAAAAGTGTTTGGGTTGTGGAGTTTGCGTGCCAACATGCCCGAT GGAGGCAATTGAGCTGGTTGAGAGGGATGAGCTGCTTGAGCTGCCAGATGGAATGACC TACGTTCAGGAGCTGCTGGCTGACAAGGGAAGAGACCCTTCAGGGCTTTTCTGAtttttc cccattaacattgaccgaaatgtgagaaatttttaaatggtttgatatttaatttctcagaaagagGTG     AF0689 Gene: AF0689     GI: 11498297     BI number: AF0689     GOG: -------     Description: hypothetical protei GG A  G        C G  A      C  T A  T      A  A G  G       GC        GA TA        TG       A  G TG        AT       A  A GC        AT        GC GT        GC        GC T  |      |  A       GC CG       |  G       AT GC       |  G      A  | AT       |  A      C  | GT       |  G       AT TG       G  C       GC TA       T  T       TA |  G      A  G       CG A  C       GC       G  | AT        AT       G  | CG        CG        TG GC        CG        CG GC        GC        GC                         TTTTCTGAtttttccccattaacattgaccgaaatgtgagaaatttttaaatggtttgatatttaatttctcagaaagagGTG     ..................................................................................................................