Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-21.07 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGTTTCGGAAAATTTGTTTTCATCAATACCCTTTATCTCACCGCTGTCTGACACGC
CAACAACGTAAAGAGCCACACCCTTTCCCATTATAATCCTGTGGTTCATCTGGCAGGC
GAGCTGCCTGAACCTGCCCTCTTTAAGGTGAAAGTTGCCCAAGAACTCCTTGAACTCT
ACGTTTTCTCCCTCTCCCCTCTCCAGGAGCTTGAGGATTTTTTCCACAATTAAATTTC
CATGTTGGGGATTTAATTTTTCCGATTGGAGCACCAAACCTTTATAATGTCCATGCAA
AATAAACACGATG

    pyrD


Gene: pyrD     GI: 11498351     BI number: AF0745     GOG: COG0167     Description: dihydroorotase dehydrogenase (pyrD


            C
          C  A
  G       C  A
C  A      G  G
G  G       TA
 GC        TA
 AT        GC
 CG        AT
 GC       A  |
 GC       A  |
T  |      G  |
C  |      T  |
T  |       GC
 AT        GC
 CG        AT
 TA        AT
 TA        TG
 GC        TA
 GC        TA
T  T      C  C
G  G      T  T
T  C      C  C
C  C      C  T
C  C      C  A
T  T       GC        CT
A  C       TG       T  C
A  T      C  T      C  C
T  T      C  T      C  A
 AT        AT        CG
 TA        AT        CG
 TA        GC        TA
A  |      T  T       CG
 CG       C  C      T  C
 CG       C  C      C  T
|  T      G  C      C  T
 CG       T  T       CG
 TA       C  |       TA
 TA        GC        CG
 TA        AT        TG
 CG        GC        TA
                        TTTTTTCCACAATTAAATTTCCATGTTGGGGATTTAATTTTTCCGATTGGAGCACCAAACCTTTATAATGTCCATGCAAAATAAACACGATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0167 Dihydroorotate dehydrogenase ... can be seen here

    ..................................................................................................................