                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAGAAGCACCTTATACCGTTCCCGCACATCGCAGCCTCGCTGCCATCGCTGTTGAA
GTACCTGAACCTGACGTCCGCCTTTTGCGAGGGCTGAACAAAAAGCGCACCGTCAGCA
CCAACGCCGAAGTTTCTGTGGCATACTGCCCTTACAAACCTCGGCTTCTCCTCTTCTC
CCACAATCACTCCTTCGAATTCGTCAATCAGGACGAAGTCGTTACCGTTACCGTGCAT
TTTAGTAAAGGCAATTCGCATgaagcaagttcgggcgagatttttaaaagttcccggcaactttatctGTG

    AF0748 --- orA --- orB --- AF0751 Gene: AF0748     GI: 11498354     BI number: AF0748     GOG: COG3199     Description: hypothetical protein Gene: orA     GI: 11498355     BI number: AF0749     GOG: COG0674,COG1014     Description: 2-oxoacid ferredoxin oxidoreductase, subunit alpha (orA) Gene: orB     GI: 11498356     BI number: AF0750     GOG: COG1013     Description: 2-oxoacid ferredoxin oxidoreductase, subunit beta (orB) Gene: AF0751     GI: 11498357     BI number: AF0751     GOG: COG1303     Description: conserved hypothetical protei TC A  A A  G CG TA GC CG TA        AA TA       A  G A  G       TG AT        GC GC       A  | CG        TA T  T       TA T  T      T  T        a C  A      T  T      c  a C  C      A  C      g  g T  C       CG        at CG        GC        at AT        TA        gc C  T       GT        Tg T  A       Cg       A  g A  C      C  a       Cg A  C      A  |       Gc CG        Ta        Cg AT        Tg        Ta CG        Gc        Tg                         atttttaaaagttcccggcaactttatctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3199 Uncharacterized conserved protein ... can be seen here [C] COG0674 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, alpha subunit ... can be seen here [C] COG1014 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit ... can be seen here [C] COG1013 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, beta subunit ... can be seen here [S] COG1303 Uncharacterized protein conserved in archaea ... can be seen here     ..................................................................................................................