                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:62 nt. Size=32 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=34 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-tatgct. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaagaagctattactcgatatgctcgatatgtataactcaaaaaatacccccagcgccggggctgggatttgaacccaggagcccttacgggcacc
agctctcaaggctggcgcagtacctctctgcaaccccggctttttccagaaactaagataacgtgtttatgaaccttgtgattatgtaagtttctggcaa
attctccgaaaaaattatatgttggctgaaatagaaagtgcATG

    AF0787 --- AF0788 Gene: AF0787     GI: 11498393     BI number: AF0787     GOG: COG4756     Description: hypothetical protein Gene: AF0788     GI: 11498394     BI number: AF0788     GOG: COG0697     Description: conserved hypothetical protei ta         c         c t  c      t  a      c  t cg       c  a      a  c cg        tg       t  t cg        cg        gc gc        gc        at a  a       at        cg gc        cg        gc gc        cg       |  a a  a      a  c      |  a c  g       cg       |  c c  c       gc       c  c c  t      g  a       gc a  c      g  |       gc at        cg        tg gc        at        cg ta        ta        gc                         tttttccagaaactaagataacgtgtttatgaaccttgtgattatgtaagtttctggcaaattctccgaaaaaattatatgttggctgaaatagaaagtgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4756 Predicted cation transporter ... can be seen here [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................