Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:115 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=31 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:54 nt.    Size=53 nt.     Delta G= -8.32 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAA-TAAACT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAAAAGGGGTACTTCTCAGCCTCATAAACTCCCATCGGCCCTCCAAGAATAACGA
TAGCGTCAAAATCTGCCATTTTTGTTTCAGAATAGGCCTCTACGTAGTAGTAATCCAC
GCCCTCTCTGCTGAGCACCTCTTCGAGGTATCCCAGACCCTCCGCGGGATGGTTTTTT
ATGGCAGCAAAAATCATgttggtgtaaatgcacagctgaaagtaaagtttttgtttggtgctgtcgactcaagcttgcATG

    AF1276


Gene: AF1276     GI: 11498875     BI number: AF1276     GOG: -------     Description: hypothetical protei


  A
C  C
C  G
T  C
A  C
A  C
T  T
 GC
 AT
T  |
 GC
 AT
 TG         T
 GC       T  C
C  T       CG
A  |       TA
T  |       CG
 CG        CG
 TA        AT         C
 CG       C  A      C  G
|  C      G  |      T  C
C  A       AT        CG
 GC        GC        CG
 GC       T  C       CG
 AT       C  |      A  A
T  C       GC       G  |
 AT        TA        AT
 AT        CG        CG
 GC        TA        CG
                        TTTTTTATGGCAGCAAAAATCATgttggtgtaaatgcacagctgaaagtaaagtttttgtttggtgctgtcgactcaagcttgcATG


    ..................................................................................................................