                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -4.84 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTATCAAAATCCTTAAGCGATACTGAtataaacaccaatgcccccctacccttaagggcccgtggctcagcatggat
agagcgacggccttctaagccgtagatcgcgggttcaaatcccgccgggtccgctccaatctaaagatttttcaaggctactaccattcagcagctttac
aattgctcagcagattgcctgagccatccacgccgattttgggaatccaggcagtttttaacacttgcctccagcaatgcggtctgataatccttaagta
tcccaacctgaatctggacacATG

    argB --- AF1279 --- AF1278 Gene: argB     GI: 11498879     BI number: AF1280     GOG: COG0548     Description: acetylglutamate kinase (argB) Gene: AF1279     GI: 11498878     BI number: AF1279     GOG: COG1082     Description: conserved hypothetical protein Gene: AF1278     GI: 11498877     BI number: AF1278     GOG: COG1915     Description: conserved hypothetical protei   a c  t c  t a  c ta cg a  c ta cg gc                   g gt                 c  a at                 c  t at                 g  t c  a                c  t t  c                 at t  a                 cg t  a                 cg t  t                 tg t  t                a  a a  g        a       c  a gc       g  t      c  t at       a  t      g  c |  c       cg       a  | |  a       gc        gc a  g      |  c       ta a  c       at        cg ta        cg        cg cg        ta        gc ta        cg        ta at        gc        tg                         tttttaacacttgcctccagcaatgcggtctgataatccttaagtatcccaacctgaatctggacacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0548 Acetylglutamate kinase ... can be seen here [G] COG1082 Sugar phosphate isomerases/epimerases ... can be seen here [S] COG1915 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................