                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.29 kcal/mol
Antiterminator:    Distance from promoter:38 nt. Size=36 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:19 nt.    Size=37 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTGGA-TACAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGGATGAGTTCATTTATTGGTACAATTACGTTAAGCCTCACATGAGCCTGAATTTC
GACGAATTGGAGACTCCCTATCAGGCCTTTTTGAGGAAGCTACCTGCTGAAAGGGTGT
TTGAGTACGGGAGGTGGTTGTTTGAGGAGTGAaattaattcgggatatcacagttgttgcttttttggattatggg
tttaaaaacctcagacgcagacaaattggattgcgattttttaggaagtaaagttttttaattgtagatttgtacaattttttcgatgaggGTG

    hydC Gene: AF1382     GI: 11498978     BI number: AF1382     GOG: -------     Description: hypothetical protei GA C  A AT        CT GT       C  T CG        GT        GT TG        GT       T  T TA        AT       G  T TG        CG       G  G |  A       TA       G  A |  C      A  |      A  G |  T      T  |      A  T |  C      C  |      A  A |  C       CG        GC |  C       CG        TG |  T       TA        CG A  A      C  A      G  G AT       A  G       TA GC        GC        CG TA        AT        CG CG       |  A       AT CG        GC        TG GC        GC        CG                         TTGTTTGAGGAGTGAaattaattcgggatatcacagttgttgcttttttggattatgggtttaaaaacctcagacgcagacaaattggattgcgattttttaggaagtaaagttttttaattgtagatttgtacaattttttcgatgaggGTG     ..................................................................................................................