Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGCACGACAGGATGACAATTGTTGGAGAGAAAGCCAAGGAAGTTGCTGACACCGCA
ATAAAAAACAACCTTCTCTCAAGGCTTGACCACGCAGCCTACCTCGGCAGGGAGCTGA
TGAAGGCCGAGATTGCAGCTTTGCTTAAAAAGAGCTACATTCAGGACAGGGAGTTGAA
TTTTGGGTTTTACCAGAAATAGctttttttgccattataacattattgttaaataggaaaatttatattgattaaagttgaatt
ggcgaaaccaagctacgggctattttttgcctattgcttgggATG

    AF1411 --- AF1410


Gene: slgB-2     GI: 11499008     BI number: AF1413     GOG: NOG06466     Description: surface layer protein B (slgB-2)
Gene: AF1412     GI: 11499007     BI number: AF1412     GOG: -------     Description: hypothetical protei


           GA
          G  C
          A  A
           CG
 TA        TG
T  A      T  G
C  A      A  |
G  A      C  |       TT
 TA       A  |      T  T
 TG        TA       G  A
 TA        CG        GC
 CG        GT        GC
 GC        AT        TA
 AT       |  G       TG
C  A      G  A       TA
 GC       A  A       TA
 TA        AT       A  A
T  T       AT       A  |
 AT        AT        GT
 GC        AT        TA
A  A       TG        TG
G  |       TG        Gc
 CG        CG        At
 CG        GT        Gt
                        tttttgccattataacattattgttaaataggaaaatttatattgattaaagttgaattggcgaaaccaagctacgggctattttttgcctattgcttgggATG


    ..................................................................................................................