                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.29 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGCCGCAAAGAACGGGGACTGGGAAACCTTCGGAGAGATGCTGAAAAAGATTGGAG
AGGTGCTGGGATACGAGGGAGAATAGctgtccaaattcaactgcgggctcggaaaatctcacgatactctgtcactcagct
tcaaagcttcccggatagtctatttcacactccatcagggctattcgttttgtcaagttattctgctggcaacgcttcaagacttcgtggattcgttttc
tgcaatatctcaatatcaaactcatgaaaaaccttattagcctcttgttatttatttgcgtATG

    aspC --- ribC --- AF1415 --- AF1414 --- 2 Gene: AF1420     GI: 11499015     BI number: AF1420     GOG: COG0330     Description: membrane protein Gene: prsA-2     GI: 11499014     BI number: AF1419     GOG: COG0462     Description: ribose-phosphate pyrophosphokinase (prsA-2) Gene: taqD     GI: 11499013     BI number: AF1418     GOG: COG0615     Description: glycerol-3-phosphate cytidyltransferase (taqD) Gene: aspC     GI: 11499012     BI number: AF1417     GOG: COG0075     Description: aspartate aminotransferase (aspC) Gene: ribC     GI: 11499011     BI number: AF1416     GOG: COG1731     Description: riboflavin synthase (ribC            ca           t  a ca        ta t  c       cg cg        gc        ac ta        at       c  t at       |  t      a  c a  a      c  c      c  c a  c      t  c      t  a at       c  c      t  t gc       a  g      t  c gt        cg       a  a cg        ta        tg |  t       gt        cg t  c       ta        tg c  a       cg        gc gc       t  t       at gt       c  c       ta gc        at        at |  a       ta        gt cg        at        gc gc        gt        cg                         ttttgtcaagttattctgctggcaacgcttcaagacttcgtggattcgttttctgcaatatctcaatatcaaactcatgaaaaaccttattagcctcttgttatttatttgcgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0330 Membrane protease subunits, stomatin/prohibitin homologs ... can be seen here [FE] COG0462 Phosphoribosylpyrophosphate synthetase ... can be seen here [MI] COG0615 Cytidylyltransferase ... can be seen here [E] COG0075 Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase ... can be seen here [H] COG1731 Archaeal riboflavin synthase ... can be seen here     ..................................................................................................................