Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -5.57 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-10.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaagtaatcaaaaatcaaagagaaagatttaagtaagttcatttctatgatatgtcacggaatagtcgcgtcggagggttttagttgggcaagaagaaat
catctaaaaaacataagaaattcaagaagactaaacctttcaaaccgaagaagaagcctaagactaaatacaggaaaaagaggaggtcgaactggcttcc
tgttctttcgctctctgctgctgttggatctagctatctgaggtatcagttaaatcttgggtatctggtaggtgttagcgccatcttttggacgatcttc
ATG

    AF1455 --- AF1454


Gene: AF1455     GI: 11499050     BI number: AF1455     GOG: -------     Description: hypothetical protein
Gene: AF1454     GI: 11499049     BI number: AF1454     GOG: COG3582     Description: hypothetical protei


  a
a  a
a  a
a  c
t  a
c  t
t  a
a  a
 cg
 ta
a  a
a  a
a  |
g  |       ta
 at       c  a
 at       c  g
 gc       g  a
a  a      a  c
a  a      a  t
c  g      g  a
g  a      a  a
g  a      a  a
g  |      g  t
 tg       a  a
 ta       a  c
 gc       g  a
 at        cg
t  |       cg
 ta       a  a
 ta       a  a
 ta       a  a
 gc       c  a
 gc        ta
 gt        tg         a
 at        ta       a  c
|  t       cg       g  t
|  c       cg        cg
|  a      a  a       tg
|  a      a  |       gc
|  a      a  |       gt
 gc        tg        at
 gc        cg        gc
 cg        at        gc
 ta        gc        at
                        gttctttcgctctctgctgctgttggatctagctatctgaggtatcagttaaatcttgggtatctggtaggtgttagcgccatcttttggacgatcttcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3582 Predicted nucleic acid binding protein containing the AN1-type Zn-finger ... can be seen here

    ..................................................................................................................