                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:52 nt.    Distance to gene:69 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -6.20 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=47 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGCT-TGAAGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCTTTTCAGGTAAAAAAGTTTGAAGTTGGCTTTGAGCGAGCTTATAGCCCGAAAG
CTTATCCTCCATtaagcaaagtggcttttaagctcgattgaaagcgatttttcttttttaaaaagcactcgtaaatttaaaacctcgccaa
atcttttatactttaaatttaactatacccATG

    AF1475 --- AF1474 --- AF1473 --- AF1472 Gene: AF1475     GI: 11499070     BI number: AF1475     GOG: COG3476     Description: mitochondrial benzodiazepine receptor/sensory transduction protein Gene: AF1474     GI: 11499069     BI number: AF1474     GOG: NOG41094     Description: hypothetical protein Gene: AF1473     GI: 11499068     BI number: AF1473     GOG: COG0784     Description: response regulator Gene: AF1472     GI: 11499067     BI number: AF1472     GOG: COG0642,COG0784,COG2202,COG2203     Description: signal-transducing histidine kinas GA C  G GC AT GT TA T  T TA        TC CG       C  C GC       C  A GC       T  T T  C       At T  G       Ta G  A       Ta A  |       Cg A  |       Gc G  |      A  a TA       A  a TA       A  a TG       G  g GC       C  t       tc AT        Cg       c  g AT        Cg       g  a A  A       Gc        at A  T       At        at A  |      |  t       tg A  |      T  t       ta T  |       At        ta GC        Ta        ta GC        Ta        cg AT        Cg        gc                         gatttttcttttttaaaaagcactcgtaaatttaaaacctcgccaaatcttttatactttaaatttaactatacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG3476 Tryptophan-rich sensory protein (mitochondrial benzodiazepine receptor homolog) ... can be seen here [T] COG0784 FOG: CheY-like receiver ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG0784 FOG: CheY-like receiver ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here [T] COG2203 FOG: GAF domain ... can be seen here     ..................................................................................................................